Human cgas uniprot

Author: imkz

August undefined, 2024

WebCyclic GMP-AMP synthase (cGAS) is a cytosolic DNA sensor that produces the second messenger cG[2'-5']pA[3'-5']p (2'3'-cGAMP) and controls activation of innate immunity in mammalian cells 1-5.Animal genomes typically encode multiple proteins with predicted homology to cGAS 6-10, but the function of these uncharacterized enzymes is … WebJul 18, 2014 · Human cGAS (also known as MB21D1) has been placed into the MAB21 family of proteins, which includes MAB21 domain-containing protein 2 (MB21D2), MAB21-like protein 1 (MAB21L1), MAB21L2 and MAB21L3.

UniProt

Webhuman CGAS HGNC:21367 ( HGNC ) 115004 ( Entrez Gene ) 613973 ( OMIM ) CGAS ( Alliance of Genome Resources ) WebCyclic GMP-AMP synthase (cGAS), also known as cGAMP synthase, h-cGAS, Mab-21 domain-containing protein 1, and encoded by the gene name MB21D1 and C6orf150, is a member of the MAB-21 family. Cyclic GMP-AMP synthase (cGAS) is a nucleotidyltransferase that catalyzes the formation of cyclic GMP-AMP (cGAMP) from … clear suspension files

Two cGAS-like receptors induce antiviral immunity in

WebCompositions and methods for treating cancer in a subject in need thereof is provided. In certain embodiments, the method includes administering therapy-induced senescent (TIS) cells and an immune checkpoint inhibitor to the subject. Also provided are compositions comprising therapy-induced senescent (TIS) cells. WebJul 5, 2005 · The cGAS-STING signaling pathway drives sterile inflammation leading to type I interferon immunopathology in severe COVID-19 disease caused by SARS-CoV-2 virus … Cite UniProt; About & Help; UniProtKB manual; Technical corner; Expert … Blast - UniProt WebAug 26, 2024 · During chemo- and radiation-therapy, self-DNA is released, and is detected by the cytosolic DNA sensor, cyclic GMP-AMP (cGAMP) synthetase (cGAS). cGAS subsequently produces the second messenger cGAMP. cGAMP binds to Stimulator of Interferon Genes (STING), leading to the recruitment and activation of Tank-binding … clear suspension file tabs

A maturation defective HIV-1 activates cGAS bioRxiv

WebMay 29, 2024 · Human cGAS (h-cGAS) constitutes an important drug target for control of antiinflammatory responses that can contribute to the onset of autoimmune diseases. Recent studies have established... WebDescription. Cyclic GMP-AMP synthase (cGAS), also known as cGAMP synthase, h-cGAS, Mab-21 domain-containing protein 1, and encoded by the gene name MB21D1 and C6orf150, is a member of the MAB-21 family. Cyclic GMP-AMP synthase (cGAS) is a nucleotidyltransferase that catalyzes the formation of cyclic GMP-AMP (cGAMP) from … clearsweet 95WebMar 29, 2024 · cGAS Antibody (D-9) is an IgG2a κ mouse monoclonal cGAS antibody that detects cGAS of human origin by WB, IP, IF, IHC(P) and ELISA. cGAS Antibody (D-9) is available as the non-conjugated anti-cGAS antibody form, as well as multiple conjugated forms of anti-cGAS antibody, including agarose, HRP, PE, FITC and multiple Alexa Fluor … clear sustainable energy trading ag

"WebUniProt. Q8TDL6 has been merged into O00391. You have automatically been redirected. " - Human cgas uniprot

Human cgas uniprot

cGAS-like receptors sense RNA and control 3

WebUniProt Q8N884 - CGAS_HUMAN. Gene CGAS View Product On Supplier's Website Request a Quote from Biorbyt. Add to Procurement List ... Cyclic GMP-AMP synthase, 2'3'-cGAMP synthase, Mab-21 domain-containing protein 1, CGAS_HUMAN. UniProt Code History L0L2J9, Q14CV6, Q32NC9, Q5SWL0, Q5SWL1, Q8N884, Q96E45. Gene … WebThe University of Houston System. Enable Screen Reader Mode ...

Did you know?

WebFeb 28, 2024 · Human cGAS catalytic domain has an additional DNA-binding interface that enhances enzymatic activity and liquid-phase condensation. The cyclic GMP-AMP … Web14 hours ago · Background: Detection of viruses by host pattern recognition receptors induces the expression of type I interferon (IFN) and IFN-stimulated genes (ISGs), which suppress viral replication. Retroviruses such as HIV-1 are subject to sensing by both RNA and DNA sensors, and whether there are any particular features of the viral genome or …

WebUniProt website fallback message If you are not seeing anything on this page, it might be for multiple reasons: ... Q8N884-1 · CGAS_HUMAN. Protein. ... Gene. CGAS. Status. … WebApr 13, 2024 · Mitochondrial inner membrane protein (Mitofilin/Mic60) is part of a big complex that constituent the mitochondrial inner membrane organizing system (MINOS), which plays a critical role in maintaining mitochondrial architecture and function. We recently showed that Mitofilin physically binds to Cyclophilin D, and disruption of this interaction …

WebHuman airway epithelial cell line (NCI‐H292) ... Cyclic GMP‐AMP synthase (cGAS) or STING knockout (KO) cells were generated to investigate their involvement. H 2 O 2 ‐induced MUC5AC expression was suppressed in STING KO cells, but not in cGAS KO cells. The epidermal growth factor receptor was comparably expressed in STING KO and … WebJun 26, 2013 · Cyclic GMP-AMP synthase (cGAS) is a cytosolic DNA sensor mediating innate antimicrobial immunity. It catalyzes the synthesis of a noncanonical cyclic dinucleotide, 2',5' cGAMP, that binds to STING and mediates the activation of TBK1 and IRF-3. Activated IRF-3 translocates to the nucleus and initiates the transcription of the …

WebJan 15, 2024 · Here, we reported the discovery of novel inhibitors for the catalytic domain of human cGAS (h-cGAS CD ) by virtual screening for the first time ... Cyclic GMP-AMP …

WebeGFP-cGAS Species H. sapiens (human) Insert Size (bp) 2385 Entrez Gene CGAS ( a.k.a. C6orf150, MB21D1, h-cGAS) Promoter LTR Cloning Information Cloning method Restriction Enzyme 5′ cloning site HpaI (not destroyed) 3′ cloning site HpaI (not destroyed) 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC 3′ sequencing primer … clear sweat proof water bottlehttp://www.ab-mart.com.cn/page.aspx?node=%2077%20&id=%2024038 bluestacks 4351372WebIn contrast to other mammals, human CGAS displays species-specific mechanisms of DNA recognition and produces less 2',3'-cGAMP, allowing a more fine-tuned response to … bluestacks 4367006WebCyclic GMP-AMP synthase (cGAS) is a signaling enzyme in human cells that controls immune-sensing of cytosolic DNA. The recent discoveries of diverse structural homologs of cGAS in animals and bacteria reveal that cGAS-like signaling is surprisingly ancient and widespread in biology. bluestacks 4360205WebIn contrast to other mammals, human CGAS displays species-specific mechanisms of DNA recognition and produces less 2',3'-cGAMP, allowing a more fine-tuned response to pathogens (PubMed:30007416).ACTIVITY REGULATION The enzyme activity is strongly increased by double-stranded DNA (dsDNA), but not by single-stranded DNA or RNA … bluestacks 4.280.4.4002 downloadWebAug 24, 2024 · The human cGAS protein (UniProt: Q8N884) was added, as well as the human oligoadenylate synthase genes (UniProt: P00973, P29728 and Q9Y6K5); these … bluestacks 4.280.30.1002WebcGAS (Cyclic GMP-AMP synthase) is a nucleotidyltransferase that catalyzes the formation of cyclic GMP-AMP (cGAMP) from ATP and GTP and plays a key role in innate immunity. Catalysis involves both the … clear sussex county nj